主要使用了EMBOSS的2个程序:tfextract, tfscan
http://emboss.sourceforge.net/apps/release/6.2/emboss/apps/tfextract.html
Please help by correcting and extending the Wiki pages.
tfextract extracts da
% tfextract Process TRANSFAC transcription factor database for use by tfscan Transfac database sites file: site.dat |
Go to the input files for this example
Go to the output files for this example
Process TRANSFAC transcription factor database for use by tfscan Version: EMBOSS:6.2.0 Standard (Mandatory) qualifiers: [-infile] infile Transfac database sites file Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: (none) Associated qualifiers: (none) General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit |
Qualifier | Type | Description | Allowed values | Default |
---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||
[-infile] (Parameter 1) | infile | Transfac database sites file | Input file | Required |
Additional (Optional) qualifiers | ||||
(none) | ||||
Advanced (Unprompted) qualifiers | ||||
(none) | ||||
Associated qualifiers | ||||
(none) | ||||
General qualifiers | ||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N |
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
-warning | boolean | Report warnings | Boolean value Yes/No | Y |
-error | boolean | Report errors | Boolean value Yes/No | Y |
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
-die | boolean | Report dying program messages | Boolean value Yes/No | Y |
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
ftp://ftp.ebi.ac.uk/pub/databases/transfac/
AC R00077 XX ID HS$ALBU_01 XX DT 20.06.90 (created); ewi. DT 24.08.95 (updated); hiwi. XX TY D XX DE albumin; Gene: G000188. XX SQ tGGTTAGtaattactaa. XX SF -363 ST -338 XX BF T00368; HNF-1A;Quality: 1; Species: human, Homo sapiens. BF T00369; HNF-1;Quality: 1; Species: rat, Rattus norvegicus. BF T01950; HNF-1B;Quality: 1; Species: human, Homo sapiens. BF T01951; HNF-1C;Quality: 1; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; OC tetrapoda; mammalia; eutheria; primates XX SO 0103; Hep3B SO 0289; rl XX MM gel retardation MM direct gel shift MM DNase I footprinting MM gel shift competition MM affinity chromatography MM methylation interference XX DR EMBL: M13075; HSALBEX1(695:711). XX RN [1] RA Frain M., Swart G., Monaci P., Nicosia A., Staempfli RA S., Frank R., Cortese R. RT The liver-specific transcription factor LF-B1 contains RT a highly diverged homeobox DNA binding domain RL Cell 59:145-157 (1989). RN [2] RA Frain M., Hardon E., Ciliberto G., Sala-Trepat J. M. RT Binding of a liver-specific factor to the human albumin RT gene promoter and enhancer RL Mol. Cell. Biol. 10:991-999 (1990). XX // [Part of this file has been deleted for brevity] DR EMBL: U11854; MM11854(1931:1941). XX RN [1] RA Feinman R., Qiu W. Q., Pearse R. N., Nikolajczyk B. RA S., Sen R., Sheffery M., Ravetch J. V. RT PU.1 and an HLH family member contribute to the myeloid-specific RT transcription of the FcgammaRIIIA promoter RL EMBO J. 13:3852-3860 (1994). XX // AC R04413 XX ID MOUSE$FCGR3A_02 XX DT 14.05.97 (created); ewi. DT 14.05.97 (updated); ewi. XX TY D XX DE FcgammaRIIIA (low-affinity Fc receptor IIIA for IgG); Gene: G001014. XX SQ TTCCTC. XX EL MRR XX SF -48 ST -43 XX BF T00702; PU.1;Quality: 3; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; OC tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae; murinae XX SO 0495; A20 SO 0848; RAW264.7 XX MM direct gel shift MM methylation interference MM supershift (antibody binding) XX DR EMBL: U11854; MM11854(1971:1976). XX RN [1] RA Feinman R., Qiu W. Q., Pearse R. N., Nikolajczyk B. RA S., Sen R., Sheffery M., Ravetch J. V. RT PU.1 and an HLH family member contribute to the myeloid-specific RT transcription of the FcgammaRIIIA promoter RL EMBO J. 13:3852-3860 (1994). XX // |
Y$ADH1_02 ACAATATGGACTTCCTCTTTTCTGG R04140 T00322; GCR1;Quality: 2; Species: yeast, Saccharomyces cerevisiae. |
HS$ALBU_01 tGGTTAGtaattactaa R00077 T01951; HNF-1C;Quality: 1; Species: human, Homo sapiens. HS$ALBU_02 TTGGCA R00078 T00599; NF-1/L;Quality: 6; Species: rat, Rattus norvegicus. HS$ALBU_03 TGGCA R00079 T00599; NF-1/L;Quality: 6; Species: rat, Rattus norvegicus. HS$ALBU_04 TTAATAAT R00080 T00015; AFP1;Quality: 6; Species: human, Homo sapiens. HS$ALBU_05 TCTAGTTAATAATCTACAAT R00081 T00369; HNF-1;Quality: 4; Species: rat, Rattus norvegicus. MOUSE$FCGR3A_01 GTCTGCTGACC R04412 T00874; USF;Quality: 2; Species: human, Homo sapiens. MOUSE$FCGR3A_02 TTCCTC R04413 T00702; PU.1;Quality: 3; Species: mouse, Mus musculus. |
The output from tfextract is a set of files in the emboss/da
These files are used by the tfscan program to search for TRANSFAC sites in sequences.
EMBOSS da
To see the available EMBOSS da
% embossdata -showall
To fetch on
% embossdata -fetch -file Exxx.dat
Users can provide their own da
The directories are searched in the following order:
The TRANSFAC Database is a commercial database of eukaryotic cis-acting regulatory DNA elements and trans-acting factors. It covers the whole range from yeast to human. An old public domain version is available at: ftp://ftp.ebi.ac.uk/pub/databases/transfac/transfac32.tar.Z
TRANSFAC started in 1988 with a printed compilation (Nucleic Acids Res. 16: 1879-1902, 1988) and was transferred into computer-readable format in 1990 (BioTechForum - Advances in Molecular Genetics (J. Collins, A.J. Driesel, eds.) 4:95-108, 1991). The basic structures of Table 1 and 2 of the compilation were taken as the core of the emergent database. The aim of the early compilation as well as of the TRANSFAC database is: 1. to guide through a meanwhile overwhelming amount of da
The program tfextract extracts da
The da
and placed in individual files:
These files are stored in the EMBOSS da
Program name | Description |
---|---|
aaindexextract | Extract amino acid property da |
cutgextract | Extract codon usage tables from CUTG database |
jaspextract | Extract da |
printsextract | Extract da |
prosextract | Processes the PROSITE motif database for use by patmatmotifs |
rebaseextract | Process the REBASE database for use by restriction enzyme applications |
评论